Gain-of-Function Smashing Success: The Key Sequence Inserted in the SARS-CoV-2 Virus Added at Least *FOUR* Distinct Functions. Coincidence?
Unpacking the evil genius of TATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT
If Fauci was a hedge fund manager, he would outperform the stock market by a wide margin. The man always gets his money’s worth from the numerous grants worth billions of dollars that he dispenses annually. His track record of producing the desired research results is so consistent that Vegas would be quickly bankrupted if they would allow people to bet on what the results of a Fauci-sponsored study would be. And as we shall see, the ROI for his Gain-of-Function grants was absolutely stupendous.
There is heightened interest in the origin of covid-19, especially now that the world has more or less acknowledged its likely laboratory provenance. A veritable flood of documents have been publicized chronicling the progress and evolution of the gain-of-function research and experiments leading up to the “emergence” of covid.
I recently had the opportunity to speak with a NIH scientist (who must remain anonymous to avoid reprisal by vengeful government bureaucrats and despotic Pharma/Tech companies) who was part of a research team that conducted experiments analyzing the genetic code (genome) for both the SARS-CoV-2 virus and the vaccines (most of which is articulated in the study The Functional Consequences of the Novel Ribosomal Pausing Site in SARS-CoV-2 Spike Glycoprotein RNA).
This scientist observed the profound improbability that the genetic sequence surrounding the Furin Site insertion possessed at least 4 distinct functional enhancements. The odds of this sort of short “super-sequence” accidentally occurring in nature are virtually nil. More importantly, the odds of the genetic engineers using an artificial inserted sequence that “just so happened” to pack 4 separate powerful enhancements are equally remote. This suggests that the devastating potency - particularly the infectiousness - of the SARS-CoV-2 virus was a deliberate construct that could have only been achieved through considerable research efforts devoted to that goal.
Another discovery that their team made was regarding the reckless use of a type of genetic modification known as “codon optimization” for the covid vaccines (to be explained further on).
This article will explain these findings & observations in layman English.
What this ultimately means, and how it fits into the broader mosaic of accumulating evidence and scientific discovery pertaining to the covid origin story, I do not know. Hopefully we will eventually get all the puzzle pieces.
Background: Some RNA and protein translation 101
Here is a brief primer explaining how RNA is written/coded and how it is converted into a protein, which is :
A protein is a string of amino acids linked together linearly like a long chain.
The RNA that is translated to create proteins is the code for the precise sequence of amino acids that the target protein is comprised of.
RNA itself is a string of nucleotides - the so-called ‘building blocks’ of the genome (although the nucleotides of RNA are not the same as those for DNA).
Amino acids are coded for by 3-nucleotide blocks called codons. For instance, 3 Cytosine nucleotides in a row (CCC) encodes for the amino acid Proline (P).
Critically, almost all amino acids have multiple codons that encode them. Here are the codons for some of the amino acids - as you can see, for all but two of the amino acids listed below there are multiple ways to code for them:
The different codons that encode for the same amino acid are not equal. For instance, there are certain codons that ‘work’ better or cause a lower ‘error rate’ specifically in human cells but not in animal cells.
“Codon Optimization” refers to changing the natural codons (as they are in nature) - in this case, the codons that the covid virus uses - to use codons that are better suited (‘optimized’) for use in human cells. The vaccine manufacturers did a heck of a lot of ‘optimizing’. The study is investigating how the vaccine’s codon optimization affects the protein translation.
Ribosomes are the ‘machines’ inside a cell that ‘read’ the RNA and create (translate) the protein the RNA codes for.
Proteins do not look like snakes, rather they fold - literally - into all sorts of intricate and complex shapes. For instance, here is a diagram (from a manufacturer) of what a typical covid virus spike protein folds into:
Notice how the ‘string’ twists and turns all over the place into a confusing and tangled monstrosity that looks nothing like a single-file chain or ‘snake’.
The shape of a protein is critical. If it’s off even a little, it could make a huge difference in its functioning and how the immune system interacts with it.
Different segments (peptides) of a protein have individual, distinct functions or properties (abilities). For instance, one segment can be poisonous or toxic while the rest is perfectly innocuous. Imagine in the picture above that the different colored parts each do something different (this is a distorted oversimplification, but that is the basic idea).
Proteins start folding while they are in the process of being translated/created. In other words, while the ribosome is busy adding on amino acids on one end, the other end is already in the process of folding. (Folding involves extremely complex biochemistry, something way beyond the scope of this article.)
Protein folding is a delicate process that can be altered, disrupted or corrupted by all sorts of things. Specifically relevant for us is that pausing or stopping the translation of the RNA into the protein in the middle will change the way it folds. Similarly, a different codon can also change how the protein folds.
Regarding the spike protein, there are 2 parts, called the S1 & the S2. The S1 is the “head” sitting on the top of the S2 “body”. The S1 contains almost all of the toxic parts of the spike protein.
SARS-CoV-2 GOF Functional Enhancements in the Key Insert Sequence
The SARS-CoV-2 spike protein is almost 1,300 amino acids long (usually referred to as “residues” or “amino acid residues”); the specific number actually varies depending on the variant. The part that we’re interested in is comprised of residues 674-685:
(#674) Y-Q-T-Q-T-N-S-P-R-R-A-R (#685)
Tyrosine (674) / Glutamine (675) / Threonine (676) / Glutamine (677) / Threonine (678) / Asparagine (679) / Serine (680) / Proline (681) / Arginine (682) / Arginine (683) / Alanine (684) / Arginine (685)
The nucleotides (remember the ‘codons’ referred to earlier) that encode for these amino acids in the original Wuhan virus genome, per Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome (nucleotides # 23,582 - 23,617 of the whole covid genome), are:
TAT / CAG / ACT / CAG / ACT / AAT / TCT / CCT / CGG / CGG / GCA / CGT
(A = Adenine, C = Cytosine, G = Guanine, T = Thymine; in RNA, T is replaced by U = Uracil)
The above sequence contains the now-infamous Moderna-patented genetic sequence - CT/CCT/CGG/CGG/GCA/CGT/AG (the last two letters are not in the above portion) - that somehow “found its way” into the SARS-CoV-2 genome (you really gotta hand it to those pesky Chinese bats, they sure cooked up a perfect genetic Frankenstein). I imagine that almost anyone reading this by now is aware that there is a Moderna-patented sequence (documented by the study MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site).
(Note: I am not getting involved in the controversy surrounding the Moderna patented sequence regarding whether it is indeed a one-in-a-billion type of “coincidence” or not. We’re dealing only with the functionality of this sequence.)
The 4 Gain of Function Enhancements in this Sequence:
The NIH scientist whom I spoke to at length made this observation to me: There are (at least) *FOUR* distinct functions of the strategic Furin Site / Moderna patent sequence insert that all enhance the virulence or pathogenicity of covid:
Furin Cleavage Site - P-R-R-A1 (residues 681-684) - dramatically increases the capacity or likelihood of the spike protein successfully fusing with the cell membrane (after initial binding with a cellular surface protein, primarily ACE2).
HIV Motif - Q-T-Q-T-N (residues 675-679) - a piece of the HIV spike protein that makes it much more infectious & possibly helps to infect T-Cells.
Enterotoxin Peptide - the entirety of the sequence - this is a peptide (piece of a protein) that is literally a potent toxin.
Ribosomal Pausing Site - CGG/CGG (nucleotides 23,606 - 23,611, coding for the back-to-back Arginine’s at residues 682-683) - significantly enhances the integrity of the spike protein translation so there will be far fewer ‘ruined’ or ‘dud’ proteins; and also leads to the creation of “half-spike proteins” - in other words, solitary S1 pieces - which are far more dangerous when they’re detached from the S2 half of the spike protein.
Enhancement #1: Furin Cleavage Site
This is a thoroughly documented feature that is a fundamental part of covid’s virulence and so doesn’t really need further fleshing out.
Briefly, the chain of events that starts with the spike protein binding with ACE2 and culminates with the fusion of the virion with the cell membrane goes something like this (very roughly):
the ‘tip’ (business end or ‘sticky’ part) of the spike protein - binds (‘sticks’) to the top of the ACE2 receptor protruding out from the membrane surface
a second cellular surface protein - TMPRSS2 - chops off the ‘head’ of the spike protein (called the S1 subunit) at the Furin Site.
The other half of the spike protein (called the S2) substantially rearranges itself into a new shape, which ‘activates’ a fusion peptide in the S2 that initiates fusion with the cell membrane, which results in the actual breaching of the cell by the covid virion.
The artificial supercharged Furin site of SARS-CoV-2 contains a “P-R-R-A” insert (that does not exist in nature using the specific codons found in SARS-CoV-2, one of the most powerful indicators of its laboratory origin) in the perfect spot to supercharge the ability of the TMPRSS2 protein to slice right through the spike protein exactly in the place it needs to be chopped to be efficiently activated (reorganized into its post-fusion conformation). Without the Furin Site, Step #2 would be considerably more difficult to pull off, so the spike protein would be properly ‘activated’ in a smaller % of infection ‘attempts’ (“docking events”).
(For the record, there are alternate options or pathways to break into cells, but that is beyond the scope of this article to address.)
Enhancement #2: HIV Motif in the Spike Protein
Right before the Furin Site, there is a Q-T-Q-T-N sequence from the HIV envelope protein, which similarly greatly enhances the virulence of covid like it does for HIV.
As described by the study An insertion unique to SARS-CoV-2 exhibits superantigenic character strengthened by recent mutations:
Further examination of the motif near PRRA reveals close structural similarity to the SEB superantigen as well as sequence similarities to neurotoxins and a viral SAg
The insertion PRRA together with the sequentially preceding seven amino acids and succeeding Arg (fully conserved among β-coronaviruses) have been pointed out to form a motif, Y[674]QTQTNSPRRAR[685], homologous to that of neurotoxins from Ophiophagus (cobra) and Bungarus genera, as well as neurotoxin-like regions from three RABV strains (21) (Fig. 2C). We further noticed that the same segment bears close similarity to HIV-1 glycoprotein gp120 superantigenic motif F164-V164.
The role of this QTQTN piece in making covid much more infectious is explained by the aptly named study QTQTN motif upstream of the furin-cleavage site plays key role in SARS-CoV-2 infection and pathogenesis:
Similarly, the QTQTN motif directly upstream of the FCS is also an unusual feature for group 2B coronaviruses (CoVs). The QTQTN deletion has consistently been observed in in vitro cultured virus stocks and some clinical isolates 3. To determine whether the QTQTN motif is critical to SARS-CoV-2 replication and pathogenesis, we generated a mutant deleting the QTQTN motif (ΔQTQTN). Here we report that the QTQTN deletion attenuates viral replication in respiratory cells in vitro and attenuates disease in vivo. The deletion results in a shortened, more rigid peptide loop that contains the FCS, and is less accessible to host proteases, such as TMPRSS2. Thus, the deletion reduced the efficiency of spike processing and attenuates SARS-CoV-2 infection. Importantly, the QTQTN motif also contains residues that are glycosylated4, and disruption its glycosylation also attenuates virus replication in a TMPRSS2-dependent manner. Together, our results reveal that three aspects of the S1/S2 cleavage site – the FCS, loop length, and glycosylation – are required for efficient SARS-CoV-2 replication and pathogenesis.
In plain English, when the scientists removed the Q-T-Q-T-N piece, it made covid far less infectious.
HIV Powers
Another even more lethal function that seems to be enabled (at least in part) by the QTQTN Motif is the ability to infect & destroy T-Cells, the pathology that is practically synonymous with HIV (this is how HIV causes AIDS, by killing off the immune system’s cells that fight infectious pathogens).
SARS-CoV-2 has been shown to infect T-Cells: ACE2-independent infection of T lymphocytes by SARS-CoV-2.
For anyone interested in a more thorough and detailed explanation, the inimitable Igor Chudov wrote a great piece on this:
Enhancement #3: Enterotoxin Peptide
The full sequence of amino acids laid out above, which includes the Moderna sequence containing the Furin site is an actual toxin. Literally:
A hyperinflammatory syndrome reminiscent of toxic shock syndrome (TSS) is observed in severe COVID-19 patients, including children with Multisystem Inflammatory Syndrome in Children (MIS-C). TSS is typically caused by pathogenic superantigens stimulating excessive activation of the adaptive immune system. We show that SARS-CoV-2 spike contains sequence and structure motifs highly similar to those of a bacterial superantigen and may directly bind T cell receptors. We further report a skewed T cell receptor repertoire in COVID-19 patients with severe hyperinflammation, in support of such a superantigenic effect. Notably, the superantigen-like motif is not present in other SARS family coronaviruses, which may explain the unique potential for SARS-CoV-2 to cause both MIS-C and the cytokine storm observed in adult COVID-19.
We recently discovered a superantigen-like motif sequentially and structurally similar to a staphylococcal enterotoxin B (SEB) segment, near the S1/S2 cleavage site of the SARS-CoV-2 spike protein, which might explain the multisystem inflammatory syndrome (MIS-C) observed in children and the cytokine storm in severe COVID-19 patients.
An insertion unique to SARS-CoV-2 exhibits superantigenic character strengthened by recent mutations
We show that SARS-CoV-2 spike has a sequence and structure motif highly similar to those of bacterial superantigens, and may directly bind to the T cell receptors. This sequence motif, not present in other coronaviruses, may explain the unique potential for SARS-CoV-2 to cause both MIS-C and the cytokine storm observed in adult COVID-19 patients.
(For reference, a ‘superantigen’ is a protein or piece of a protein that triggers the immune system to go bonkers on the inflammation, like what happens in the covid cytokine storm.)
It goes without saying that being a toxin expands and amplifies the harm that a pathogen can inflict on you.
A Possible Reason for the Reduced Lethality of Omicron
A bright spot amidst this Hydra-like sequence is that two of the Omicron mutations - N679K and P681H (‘K’ (Lysine) instead of ‘N’ (Asparagine) at residue #679 & ‘H’ (Histidine) instead of ‘P’ (Proline) at residue 681) - fundamentally alter crucial chemical properties of the toxin peptide in a way that compromises its toxicity, which might be one of the reasons that Omicron causes a far more mild course of disease than prior variants.
Enhancement #4: Ribosomal Pausing Site
One of the primary findings of the paper around which I organized much of this article (The Functional Consequences of the Novel Ribosomal Pausing Site in SARS-CoV-2 Spike Glycoprotein RNA) was that part of the Furin Site - the CGG/CGG codons - is what is known as a “ribosomal pausing site” (hereafter RPS).
An RPS essentially is a piece of the RNA that causes the Ribosome to “take a break” from translating the RNA into the protein. Pausing translation alters how the protein folds. Pausing the translation also sometimes leads to stopping altogether, so that the RNA after the RPS doesn’t get translated at all, and you’re left with “half-protein”.
The study discovered that for the SARS-CoV-2 virus, the RPS seemed to significantly help improve the % of proteins that folded correctly. In other words, spike proteins made from RNA that contained the RPS functioned better than spike proteins translated from RNA that did not have the RPS. (They ascertained the functionality (in layman terms) by attaching the spike proteins to fake virus particles (pseudovirions) & measuring how good these ‘fake’ virions were at infecting cells.) This is a big boost to the infectiousness of covid.
The study also discovered that there were a significant quantity of “half-spikes” - the free-floating S1 “head” pieces - created when the RNA had the RPS versus RNA that did not have the RPS. Remember, the S1 is the part that has almost all of the toxic pieces of the spike protein. The S1 when detached is able cross the various blood-barriers (such as blood-brain barrier), which can cause all sorts of really nasty injuries and debilitating conditions.
Returning to the observation of the NIH scientist that the chances that adding one sequence would have *FOUR* distinct significant enhancements to its virulence and pathogenicity is negligible - if this was “accidental”, that would make them the unluckiest scientists in the world. After all, how can anyone have predicted that their ‘innocent’ ‘well-intentioned’ biodefense research would suffer the equivalent of getting struck by lightning four times?
Bonus Enhancement #5? Cancer Potential
Can this sequence also play a role in the development of cancers down the road? That would make Daszak, Baric & Co the literal incarnation of Murphy’s Law…
Vaccine Design: Codon Optimization
This is an entirely separate finding of the study that discovered the ribosomal pausing site in the SARS-CoV-2 virus genome. However, it is another instance of the same reckless tinkering carried out by egotistical scientists with a massive god-complex, and part of the same study and on the same basic topic, so I figured it was worthwhile to discuss it here.
Alarmingly, the scientists who designed the vaccines were incredibly sloppy and shortsighted. In their myopic desire to squeeze out every last drop of potential protein production, they put all their efforts into ensuring that the mRNA wouldn’t degrade and maximizing the yield of every strand of mRNA to the extent humanly possible. One of the tactical choices made was employing codon optimization all throughout the spike genome. (There were a few other reckless choices as well.) They never considered that recklessly modifying the virus genome for the vaccine product could lead to unintended consequences. Unfortunately, codon optimization significantly distorts the functionality and properties of the mRNA, especially the translation process, an oversight with potentially unpropitious consequences.
What did the study discover?
First off, they observed that the codon optimization achieved its objective, significantly boosting the protein yield of the mRNA in the vaccines. Unfortunately for us, since spike proteins are incredibly toxic, that is not a good thing, and it’s all downhill from here.
Next, they discovered that the vaccine optimized spike proteins were carrying an whole smorgasbord of different mutations all across the spike protein. Curiously, despite producing a far greater quantity of spike protein, the psuedovirions using a far lower quantity of the native virus spike protein were nevertheless far more infectious than the psuedovirions that had a greater reservoir of the modified vaccine spike proteins. Put simply, the mutant spikes produced from the vaccine mRNA functioned about as well as low quality cheap Chinese knockoffs. This is not to say that all of the spike proteins were “messed up”, just that an appreciable percentage of them were.
This has some chilling implications for the immune response elicited by the vaccines (obviously we don’t care whether the vaccine spike proteins would work well if they were attached to real covid virus particles). Spike proteins that are mutated weirdly in a variety of ways will cause the immune system to produce antibodies to their bizarre or misshapen spike peptides. Such antibodies will not work all that well if at all against an actual covid virus spike protein, because the pathogen-specific cells, particularly the T/B-Cells & antibodies, generated against the vaccine spikes are programmed to recognize and bind to a part of the spike protein that doesn’t actually exist on the virus spike protein (of any variant).
Might these sorts of hobbled antibodies cause or supercharge an ADE (Antibody Disease Enhancement) or OAS (Original Antigenic Sin or Antigenic Priming) pathology because a significant portion of the antibodies created in response to the vaccine could be targeting these mutant spikes? Very plausibly, yes.
(Briefly, ADE refers to a phenomenon whereby substandard immune cells that are specific to a pathogen instead of helping to fight the pathogen make the pathogen more ‘powerful’ or potent; OAS refers to the phenomenon whereby the immune system ‘locks in’ the first version of a pathogen it is exposed to, so that if you subsequently get infected by a different strain of that pathogen, instead of making a new batch of immune-specific cells to match the ‘updated' parts of the new strain of the pathogen, the immune system manufactures the immune cells designed for the original strain to fight the new strain.)
And that’s not all. As everyone is probably also aware, spike protein pieces have been discovered to be capable of penetrating the cell nucleus, where they can damage or inhibit DNA repair mechanisms that are necessary to prevent undesirable developments such as cancers (and perhaps also interfere with other critical functions that we haven’t discovered yet). So what can an assortment of weirdly mutated spike bits do? Where might they end up? Good questions, but considering the mind-numbing carnage already wreaked by the covid vaccines so far, the answer is likely to be uncomforting.
Ultimately, we have no idea of what potentially toxic mutant peptides might be produced in relevant quantities, and where in the anatomy such toxicities might be manifest; and nor do we know how this affects the immune system. That we are burdened by such profound unknowns regarding the vaccine products is a testament to the utter and complete collapse of the regulatory regime.
If you notice something that is inaccurate or incorrect, I would be very grateful for you to leave a comment.
Some studies refer to the Furin Site as encompassing the residue before and/or after PRRA, a distinction that does not make a difference for the purposes of this article.
I read your article like it was a detective story. A great one!!!! Thanks for bringing all these facts together!
Before I read to BONUS ENHANCEMENT # 5, I was thinking " Cancers are going to explode".